S. No. Gene Species/Type Primer Name Sequence Orientation Technique Reference
1 16s rRNA Pathogenic and Non Pathogenic A GGCGGCGCGTCTTAAACATG F PCR 1400983
2 16s rRNA Pathogenic and Non Pathogenic B TTCCCCCCATTGAGCAAGATT R PCR 1400983
3 16s rRNA Pathogenic and Non Pathogenic C CAAGTCAAGCGGAGTAGCAA F PCR 1400983
4 16s rRNA Pathogenic and Non Pathogenic D CTTAACCTGCTGCCTCCCGTA R PCR 1400983
5 16s rRNA Pathogenic G1 CTGAATCGCTGTATAAAAGT F PCR 8409911
6 16s rRNA Pathogenic G2 GGAAAACAAATGGTCGGAAG R PCR 8409911
7 16s rRNA Pathogenic B64-I CTGAATTCTCATCTCAACTC F PCR 8409911
8 16s rRNA Pathogenic B64-II GCAGAAATCAGATGGACGAT R PCR 8409911
9 Genomic DNA L. interrogans serovar Lai LP1 ATACAACTTAGGAAGAGC PCR 8027306
10 Genomic DNA L. interrogans serovar Lai LP2 GCTTCTTTGATATAGATCAA PCR 8027306
11 Lipl21 Pathogenic lipL21 CGCGGTCGACATGATCAATAGACTTATAGCTC F PCR 17585694
12 Lipl21 Pathogenic lipL21 CGCGCTGCAGTTATTGTTTGGAAACCTCTTG R PCR 17585694
13 LipL32 Pathogenic lipL32 GTCGACATGAAAAAACTTTCGATTTTG F PCR 17585694
14 LipL32 Pathogenic lipL32 CTGCAGTTACTTAGTCGCGTCAGAAGC R PCR 17585694
15 16s rRNA Pathogenic Lepat1 GAGTCTGGGATAACTTT PCR 9066106
16 16s rRNA Pathogenic Lepat2 TCACATCG(CT)TGCTTATTTT PCR 9066106
17 16s rRNA Saprophytic Sapro1 AGAAATTTGTGCTAATACCGAATGT PCR 9066106
18 16s rRNA Saprophytic Sapro2 GGCGTCGCTGCTTCAGGCTTTCG PCR 9066106
19 16s rRNA Pathogenic L3 TGAGGGTTAAAACCCCCAAC semi nested PCR 9066106
20 16s rRNA Pathogenic L4 GAT(CTG)T(GTA)(CT)(GA)GGTAAAGATT(CT)ATT semi nested PCR 9066106
21 hap1 Pathogenic Adia214 GCAAGCATTACCGCTTGTGG F PCR 15686847
22 hap1 Pathogenic Adia215 TGTTGGGGAAATCATACGAAC R PCR 15686847
23 16s rRNA Pathogenic and Non Pathogenic Lep1 GGAACTGAGACACGGTCCAT F Duplex PCR 17124990
24 16s rRNA Pathogenic and Non Pathogenic Lep2 GCCTCAGCGTCAGTTTTAGG R Duplex PCR 17124990
25 LipL32 Pathogenic Lep3 AAGAATGTCGGCGATTATGC F Duplex PCR 17124990
26 LipL32 Pathogenic Lep4 CCAACAGATGCAACGAAAGA R Duplex PCR 17124990
27 LipL32 Pathogenic LipL32-45F AAG CAT TACCGC TTG TGG TG F PCR 19395218
28 LipL32 Pathogenic LipL32-286R GAA CTCCCA TTT CAG CGA TT R PCR 19395218
29 gyrB Pathogenic 2For TGAGCCAAGAAGAAACAAGCTACA F PCR and real time PCR 17067399
30 gyrB Pathogenic 504Rev MATGGTTCCRCTTTCCGAAGA R PCR and real time PCR 17067399
31 flaB Pathogenic L-flaB-FI TCTCACCGTTCTCTAAAGTTCAAC F PCR 11497225
32 flaB Pathogenic L-flaB-RI CTGAATTCGGTTTCATATTTGCC R PCR 11497225
33 ompL1 Pathogenic Intergroup A fwd CTACTGGCGGCTTGATCAAC F PCR 17020546
34 ompL1 Pathogenic Intergroup A rev CTGGATCTGTTCCGTCTGCGATC R PCR 17020546
35 ompL1 Pathogenic Intergroup B fwd CTTGATAGAACCACTGGTGGTGCC F PCR 17020546
36 ompL1 Pathogenic Intergroup B rev CTGGATCGGTTCCATCGCTCAG R PCR 17020546
37 ompL1 Pathogenic Borgpeter fwd CTTGATAGAACAACAGGCGGCATCATC F PCR 17020546
38 ompL1 Pathogenic Borgpeter rev GCTAATAAGTTTGCAATGCTCGTAAC R PCR 17020546
39 ompL1 Pathogenic Kirschner fwd CGGTTTGATCAATGCGAGAAGCACC F PCR 17020546
40 ompL1 Pathogenic Kirschner rev TTGGATCCGTTCCGTCTGCGATT R PCR 17020546
41 ompL1 Pathogenic Santarosai fwd CTTATCAATGCAAGATCTACCAAAGGT F PCR 17020546
42 ompL1 Pathogenic Santarosai rev GCGGATATGTTCCCGAGTAGTAATC R PCR 17020546
43 ompL1 Pathogenic Noguchii fwd GCGGATTTATCAATGCAAGAAGTACA F PCR 17020546
44 ompL1 Pathogenic Noguchii rev CCGGATCGGTTCCGTCTGCGATCAG R PCR 17020546
45 ompL1 Pathogenic Weilii fwd AGGCTGATATTGCAGGCTTC F PCR 17020546
46 ompL1 Pathogenic Weilii rev CGGAATCGAATATGTTCACGAGTG R PCR 17020546
47 lig gene Pathogenic Lig1 TCAATCAAAACAAGGGGCT PCR 15680212
48 lig gene Pathogenic Lig2 ACTTGCATTGGAAATTGAGAG PCR 15680212
49 lig gene Pathogenic LigConF CCGAATATTCCTCTCGGAAA F Real time PCR 15680212
50 lig gene Pathogenic LigConR AAGGCTGCTGGAGTAACGAT R Real time PCR 15680212
51 LipL32 Pathogenic Lauo1 ACTCTTTGCAAGCATTACCGC mPCR 23610544
52 LipL32 Pathogenic Lauo2 AGCAGACCAACAGATGCAACG mPCR 23610544
53 16s rRNA Leptospira species 16S-1507 CCAGATCTGAGC TCAAGGAGGTGATCCAGC PCR 8094390
54 16s rRNA Leptospira species 16S-11 GGCTGCAGTCGACGTTGATCCTGGCTCAG PCR 8094390
55 23S rrl Leptospira species 23S-1432 GGTGTCGACTATGAACCTGCTCCCATCGACTAC PCR 8094390
56 23S rrl Leptospira species 23S-220 AAC CAGAATTCCGTCAGTAGCGGTGAGCGAA PCR 8094390
57 16s rRNA Pathogenic fD1 CCGAATTCGTCGACAACAGA F PCR 17021075
58 16s rRNA Pathogenic GTTTGATCCTGGCTCAG PCR 17021075
59 16s rRNA Pathogenic rP2 CCCGGGATCCAAGCTTACGG R PCR 17021075
60 16s rRNA Pathogenic Lepto F CCCGCGTCCGATTAG Taqman assay(RRS GENE) 12100734
61 16s rRNA Pathogenic Lepto R TCCATTGTGGCCGR(A/G)ACAC Taqman assay(RRS GENE) 12100734
62 lig A/B Pathogenic ligA/B-P1 CGGTTCTCACTTCTATTCAA F multiplex real-time PCR(taqman) 21033579
63 lig A/B Pathogenic ligA/B-P2 ATTGAAGAATCGGATGAGAA R multiplex real-time PCR(taqman) 21033579
64 16s rRNA Leptospira species 16S-P1 TAGTGAACGGGATTAGATAC F multiplex real-time PCR(taqman) 21033579
65 16s rRNA Leptospira species 16S-P2 GGTCTACTTAATCCGTTAGG R multiplex real-time PCR(taqman) 21033579
66 23S rRNA gene Non pathogenic 23S-P1 ACAATCTTACCAAACCCTATC F multiplex real-time PCR(taqman) 21033579
67 23S rRNA gene Non pathogenic 23S-P2 TTACCACTTAGCGTAGATTT R multiplex real-time PCR(taqman) 21033579
68 16s rRNA Leptospira species CGCTGGCGGCGCGTCTTAAA PCR 1372872
69 16s rRNA Leptospira species AAGGTCCACATCGCCACTT PCR 1372872
70 16s rRNA Pathogenic AGGGAAAAATAAGCAGCGATGTG PCR 10878072
71 16s rRNA Pathogenic ATTCCACTCCATGTCAAGCC PCR 10878072
72 16s rRNA Pathogenic GAAAACTGCGGGCTCAAAC nested PCR 10878072
73 16s rRNA Pathogenic GCTCCACCGCTTGTGC nested PCR 10878072
74 23S rDNA Leptospira species L737 GACCCGAAGCCTGTCGAG PCR 9399509
75 23S rDNA Leptospira species L1218 GC CATGCTTAGTCCCGATTAC PCR 9399509
76 16s rRNA Leptospira interrogans serovar canicola Lep 1 GGC GGC GCG TCT TAA ACA TG PCR 9399509
77 16s rRNA Leptospira interrogans serovar canicola Lep 2 TTCCCC CCA TTG AGC AAG ATT PCR 9399509
78 16s rRNA Pathogenic and saprophytic LG1 CGG TGA AAT GCGTAG ATA TC PCR 26927873
79 16s rRNA Pathogenic and saprophytic LG2 CGG TTT GTC ACC GGCAGT TC PCR 26927873
80 secY Pathogenic SecYII GAA TTT CTCTTT TGA TCT TCG F PCR 25398140
81 secY Pathogenic SecYIV GAG TTA GAGCTC AAA TCT AAG R PCR 25398140
82 lipL32 Pathogenic 45F AAG CAT TAC CGC TTG TGG TG F PCR 25398140
83 lipL32 Pathogenic 286R GAA CTC CCA TTT CAG CGA TT R PCR 25398140
84 secY L. interrogans PFLint2 CTT GAG CCT GCG CGT TAY C F PCR 25398140
85 secY L. interrogans PRLint2 CCG ATA ATT CCA GCG AAG ATC R PCR 25398140
86 ompL1 L. borgpetersenii F_bpn GAT TCG GGT TAC AAT TAG ACC F PCR 25398140
87 ompL1 L. borgpetersenii R_bpn1 TTG ATC TAA CCG GAC CAT AGT R PCR 25398140
88 secY L. kirschneri F_nery CTG GCT TAA TCA ATG CTT CTG F PCR 25398140
89 secY L. kirschneri R_nery CTC TTT CGG TGA TCT GTT CC R PCR 25398140
90 secY L. noguchii FLnog2 TCA GGG TGT AAG AAA GGT TC F PCR 25398140
91 secY L. noguchii RLnog2 CAA AAT TAA AGA AGA AGC AAA GAT R PCR 25398140
92 lipL32 Pathogenic LipL32-270F CGCTGAAATGGGAGTTCG TATGATT F Real time PCR 15591254
93 lipL32 Pathogenic LipL32-692R CCAACAGATGCAACGAAAGATCCTTT R Real time PCR 15591254
94 genomic DNA Pathogenic DH79 CAT GAA AGC GGC AAG AGG AGC PCR 9008795
95 genomic DNA Pathogenic RH79 CTT CAC GTC GGCTCT AGA CAA PCR 9008795
96 genomic DNA Pathogenic DHN TCA CGG AAG TTT ACG GAT PCR 9008795
97 genomic DNA Pathogenic RHN CGA TAT TCA TAC AA PCR 9008795
98 rpoB gene Leptospira species 740F TGGITIGAATTIGAIATIGA PCR 10834976
99 rpoB gene Leptospira species 1130F AATTGICTIGAAIIAGA PCR 10834976
100 rpoB gene Leptospira species 1730F CTTGGICCIGGIGGACTTTC PCR 10834976
101 rpoB gene Leptospira species 1730R GAAAGTCCICCIGGICCAAG PCR 10834976
102 rpoB gene Leptospira species 1920F GAAGGICCAAAIATIGG PCR 10834976
103 rpoB gene Leptospira species 1920R CCIATITTTGGTCCTTC PCR 10834976
104 rpoB gene Leptospira species 2900F ATGCIATITTIATTTC PCR 10834976
105 rpoB gene Leptospira species 2900R AGAAATIAAIATIGCATCCTC PCR 10834976
106 rpoB gene Leptospira species 3700R GCGTGIATTTTITCATCIAC PCR 10834976
107 rpoB gene Leptospira species 3850R GCTTCIAGIGCCCTIAC PCR 10834976
108 LA0322 Leptospira Interrogans Lai LFB1-F CATTCATGTTTCGAATCATTTCAAA F Real time PCR 16006065
109 LA0322 Leptospira Interrogans Lai LFB1-R GGCCCAAGTTCCTTCTAAAAG R Real time PCR 16006065
110 23S rDNA Leptospira species L737 GACCCGAAGCCTGTCGAG rapid cycle PCR 9399509
111 23S rDNA Leptospira species L1218 GC CATGCTTAGTCCCGATTAC rapid cycle PCR 9399509
112 flaB Pathogenic flaB-F2 TGTGCACAAGACGATGAAAGC nested PCR 19050356
113 flaB Pathogenic flaB-R2 AACATTGCCGTACCACTCTG nested PCR 19050356
114 23s rDNA Leptospira interrogans serovar hardjo, type hardjobovis, strain HB013 CGGTTCGTAA AACGAGACAA PCR 2584377
115 23s rDNA Leptospira interrogans serovar hardjo, type hardjobovis, strain HB014 ACTTTTCGGC GAGCAATAGC PCR 2584377
116 16S rRNA Leptospira species 16S forward CGGGAGGCAGCAGTTAAGAA PCR 24671788
117 16S rRNA Leptospira species 16S reverse AACAACGCTTGCACCATACG PCR 24671788
118 16S rRNA Leptospira species 16S-1 GCGTAGGCGGACATGTAAGT F PCR 26091292
119 16S rRNA Leptospira species AATCCCGTTCACTACCCACG R PCR 26091292
120 16S rRNA Leptospira species 16S-2 TAAAGGCTCACCAAGGCGAC F PCR 26091292
121 16S rRNA Leptospira species TTAGCCGGTGCTTTAGGCAG R PCR 26091292
122 LipL32 Pathogenic LipL32-1 GCCGTAATCGCTGAAATGGG F PCR 26091292
123 LipL32 Pathogenic CTTTGGCGATTTGGTCAGGC R PCR 26091292
124 LipL32 Pathogenic LipL32-2 TGGCTATCTCCGTTGCACTC F PCR 26091292
125 LipL32 Pathogenic CCCATTTCAGCGATTACGGC R PCR 26091292
126 flaB Pathogenic FlaB-1 GCTCGTGCAGGTGGAAGTAT F PCR 26091292
127 flaB Pathogenic GCCTTTGAAGTCATCGTGCC R PCR 26091292
128 flaB Pathogenic FlaB-2 GCTAACGACGTGATCGGTCT F PCR 26091292
129 flaB Pathogenic CGAGACAACTTCTTCCGCCA R PCR 26091292
130 LipL41 Pathogenic LipL41-1 GTGCAGACGCAATCAACGAA F PCR 26091292
131 LipL41 Pathogenic GCGAAACCTGCCACTTTCAA R PCR 26091292
132 LipL41 Pathogenic LipL41-2 CGTAGGTTTGGCTGTTGAAGC F PCR 26091292
133 LipL41 Pathogenic GCGTCTGCACGTTTACTCAG R PCR 26091292
134 LipL31 Pathogenic LipL-31 TCGATGCGATGAGTCGAGTT F PCR 26091292
135 LipL31 Pathogenic AACCGTCTTTTTCAGCTGCG R PCR 26091292
136 genomic DNA Leptospira species PB-1 GCGCTGGCTCAG AP-PCR 9060879
137 Lipl32 Pathogenic P23 CAA GCG CCG GAC GGT TTA GT PCR 9060879
138 Lipl32 Pathogenic P24 ACG GGC TCA CA CTG GAA TAC C PCR 9060879
139 LipL21 Leptospira/LipL21 P28/F CCAGCACTGACACCGGACAAA F PCR 9060879
140 LipL21 Leptospira/LipL21 P29/R CCGGAACCAACCGCTTTACAT R PCR 9060879
141 LipL41 Leptospira/LipL41 P30/F GACCTCAGTAAACGCGCCGATAT F PCR 9060879
142 LipL41 Leptospira/LipL41 P31/R CAGCGGCTTCGTCCAATCCT R PCR 9060879
143 LipL32 Pathogenic CTC GAGCATATGGGTGCTTTCGGTGGTCTG F PCR 21487641
144 LipL32 Pathogenic AAGCTTACTTAGTCGCGT CAGAAGC R PCR 21487641
145 LipL32 (LA2637) Pathogenic LipL32-Rb GAACTCCCATTTCAGCGAT PCR 21471336
146 16S rRNA Pathogenic/Intermediate rrs-outer-F CTCAGAACTAACGCTGGCGGCGCG F PCR 22151687
147 16S rRNA Pathogenic/Intermediate rrs-outer-R GGTTCGTTACTGAGGGTTAAAACCCCC R PCR 22151687
148 16S rRNA Pathogenic/Intermediate rrs-inner-F CTGGCGGCGCGTCTTA F PCR 22151687
149 16S rRNA Pathogenic/Intermediate rrs-inner-R GTTTTCACACCTGACTTACA R PCR 22151687
150 rpoB Leptospira species Lept 1900f CCT-CAT-GGG-TTC-CAA-CATGCA PCR 16978348
151 rpoB Leptospira species Lept 2500r CGC-ATC-CTC-RAA-GTTGTA-WCC-TT PCR 16978348