CRISPR Name CRISPR(position) REPEAT(sequence) SPACER(sequence)
CRISPR1 3423629 TTCTAAACCGCCTATCGGCATCAAAGTTATATTCAGA AGTTTTTCACGGGGTGACGAATGTTTTCCCCTT
3423699 GTGCTCAACGCCTAACGGCATCAAAGTTATATTCAGC CCATAACGATACATTATGGGAAGTTTGGTCCTATGTCC
3423774 GTGCTCAACGCCTAACGGCATCAAAGTTATATTCAGA AATCAAGGACGAATTCTTTTGATCAAAGGATCCTTT
3423847 GTGCTCAACGCCTAACGGCATCAAAGTTATATTCAGA