CRISPR Name CRISPR(position) REPEAT(sequence) SPACER(sequence)
CRISPR 1 727419 CGGTTCAACCCCACGCATGTGGGGAAAAG GAATCTGATTGCCGGAACTAAAATTCCCAGCT
727480 CGGTTCAACCCACGCGTGTGGGGAAAAGT AAACGCATGACAAGTGAAAGTTAAGACTTAAC
727541 TGGTTCAACCCCACGCATGTGGGGAAAAG CAGATCTATGCGGTGCAAATCTACGCGGTGTG
727602 CGGTTCAACCCCACGCATGTGGGGAAAAG CTACGATCCTTAATTTCGATTCGCCAGAAGAG
727663 CGGTTCAACCCCACGCATGTGGGGAAAAG ATCCATGCCCTTGATTTCAGAATCTGTAAACC
727724 CGGTTCAACCCCACGCGTGTGGGGAAAAG TCGGATGAGTCCTGGGACTGGCTCCGCGCGAC
727785 CGGTTCAACCCCACGCATGTGGGGAAAAG GCTTCTTACATTTCCTTGTCCGCATACGCTGA
727846 CGGTTCAACCCCACGCATGTGGGGAAAAG GATTTCTTCTATGGTGGGCATTTGTGTTGTTC
727907 CGGTTCAACCCCACGCATGTGGGGAAAAG ATCCATGCCCTTGATTTCAGAATCTGTAAACC
727968 CGGTTCAACCCCACGCATGTGGGGAAAAG
CRISPR 2 843351 CAATGAAATGCCCCCACGCATGTGGGGAAAAG CAGAAAAGAAAGCTCGTCCGATCATTGTT
843412 CCACGGTTCAACCCCACGCATGTGGGGAAAAG GCTTCACTTGCTCGTAAAAATTCGGTCCA
843473 CCACGGTTCAACCCCACGCATGTGGGGAAAAG ATGGGATATATTGGTCAAGGCGATGCCCG
843534 TTTCGGTTCAACCCCACGCATGTGGGGAAAAG
CRISPR 3 3073836 CTTTTCCCCACATGCGTGGGGTTGAACC GATGTAATGATAGATATTGGTCGAAGAATTCTT
3073897 CTTTTCCCCACATGCGTGGGGTTGAACC AACAACTCGAAGAACTTGCGCGACAATTCGTTT
3073958 CTTTTCCCCACATGCGTGGGGTTGAACC GTTTACCTTTTTCTTTTGCCTTTCTTCGGAGC
3074018 CTTTTCCCCACATGCGTGGGGTTGAACC GAGAAAGAAGAAAAAAAAGAATCTCTATCGTCA
3074079 CTTTTCCCCACATGCGTGGGGTTGAACC GCCGGGGAAGCCGGCATTCGTTTGTCTGAGTT
3074139 CTTTTCCCCACATGCGTGGGGTTATTCA
CRISPR 4 3350420 CTGAATATAACTTTGATGCCGTAAGGCGTTGAGCAC AATATATAGGGCAGTTGCTCGGGATGGCGACGACTACA
3350494 CTGAATATAACTTTGATGCCGTAAGGCGTTGAGCAC AATATAAGAAGAAAGAAAACTGGTTTTTAGCAGAG
3350565 CTGAATATAACTTTGATGCCGTAAGGCGTTGAGCAC CTGCATTAACACTAATGCTTCACTTCCTTTTTGTGT
3350637 CTGAATATAACTTTGATGCCGTAAGGCGTTTCACTT