CRISPR Name CRISPR(position) REPEAT(sequence) SPACER(sequence)
CRISPR1 3122125 GAACTCATGTTGAGTAAGAGGAAAAAACG AACTTCCATTTCGCCTTTGGCCACTTTACCGACATTTCAAGT
3122196 CACTTTCCCTTGAATAAGAGAAAGAAACG ATTTTATCTGCAACATATATTCCTAATGTTAAGGTGTTTCAATC
3122269 CACTTTCTCTTGAATAAGAAAAAGAAACT TTAGAAATTTGTAATAAACAACGTGAATTGATGTTTCAATC
3122339 CACTTCCTCTTGAATAAGAGAAAGAAACG