CRISPR Name CRISPR(position) REPEAT(sequence) SPACER(sequence)
CRISPR1 3122078 GAACTCATGTTGAGTAAGAGGAAAAAACG AACTTCCATTTCGCCTTTGGCCACTTTACCGACATTTCAAGT
3122149 CACTTTCCCTTGAATAAGAGAAAGAAACG ATTTTATCTGCAACATATATTCCTAATGTTAAGGTGTTTCAATC
3122222 CACTTTCTCTTGAATAAGAAAAAGAAACT TTAGAAATTTGTAATAAACAACGTGAATTGATGTTTCAATC
3122292 CACTTCCTCTTGAATAAGAGAAAGAAACG