CRISPR Name CRISPR(position) REPEAT(sequence) SPACER(sequence)
CRISPR1 1136094 GTTTCTTTTTCTTATTCAAGAGGAAGTGGATTGAAA CAAATTTCCCACGCGTGGGAAATTTGGCTCATTCGA
1136166 GTTTCTTTCTCTTATTCAAGAGGAAGTGCATTGAAA CAAATGTAAACTCAGATTTACATTTGATTGAAGCG
1136237 GTTTCTTTCTCTTATTCAAGAGAAAGTGAATTGAAA TGTCGGTAAAGTGGCCAAAGGCGAAATGGAAGTTC
1136308 GTTTTTTCCTCTTACTCAACATGAGTTCCTACAATT
CRISPR2 3202940 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC GCTACAAGGGATGTTCTTGCAATTGATACTGTTGCTT
3203013 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC GATCAAGGGCGAAAACTTCCGGCGGAAATTACGACGG
3203086 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC GTTAGATTTAAGTCTCTTGGTTGAACTTCAATCGGTG
3203159 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC CGAAAAGAATTTTTAACAAAAACTCTATTTAAAG
3203229 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC AATTGAATAAACCCATAGGGTTTTCCGTGCCGGAA
3203300 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC AGCGTGCAACAAAACACGGAATACAATTCTCTTTGC
3203372 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC CTTCTCGCTCCGTCAGGATTACAGATATAAAGATT
3203443 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC GATTCCTTGACCCTGCGTTTACTTGTGGTCCTAC
3203513 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC ACGTAAAGGTAGAGCTTCCGTATAGATCTGATTTA
3203584 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC AATTCTCTCAATGCTCTCGTTGTAAGACGTATCATTCT
3203658 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC ATTAGTTCGGATTCATTGAGTTCAAAGTCTCTTCCC
3203730 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC CAAAGAAAAGCGCTCCAGAAGCAAACAACAGCTC
3203800 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC AATTATATCCGACTTCTTTTTACCGGTCTTAGGGGC
3203872 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC GAATACAACCTCTTCAAAAAAGAGGAACCGGCGT
3203942 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC AGTTGATAGAGCGGTACTTCTAAAACTTTTTCCATC
3204014 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC CAAGAGAAGCAGGACAAAGACGGAAACAAGTTTTTC
3204086 CTGAATATAACTTTGATGCCGTTAGGCGGTTTAGAA
CRISPR3 3204542 ACTTACAAAAATCGGGTGCCGGTAGGCGTTGAGCAC GGATTAGCGTTTGGGGTTCCACGGCTTGGGGTATC
3204613 CTGAATATAACTTTGATGCCGGTAGGCGTTGAGCAC ATCTTACGATTCTTGTTGGAAGAAACTCAATCTG
3204683 CTGAATATAACTTTGATGCCGCTAGGCGTTGAGCAC ATTTGACTCTGCAAAACTTTTGCCTCAAATTCAGGA
3204755 CTGAATATAACTTTGATGCCGTTAGGCGATTTAGAT
CRISPR4 3206161 CTTACAAAAATCAGGATGCCGGTAGGCGTTGAGCAC TTGATCACGACCGGGACTTTGATTGCTGTAGCTAT
3206232 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC ATACCACGTCTACCGCAATCTCTAAAAACTTCGCA
3206303 CTGAATATAACTTTGATGTCGTTAGGCGTTGAGCAC TCTTCAAGAACGAGATACATTGCGGTAAGAGAGGC
3206374 CTGAATATAACTTTGATGCCGATAGGCGTTGAGCAC GCCCAGTGATAAGGTCGGACGCCGTGAATACACCGG
3206446 CTGAATATAACTTTGATGCCGTTAGGCGATTTAGAC
CRISPR5 3206638 ACTTACAAAAATCGGGTGCCGGTAGGCGTTGAGCAC TCAAACAAGGCGGGAGGCGGCGGAGGGATTTTACT
3206709 CTGAATATAACTTTGATGCCGATAGGCGTTGAGCAC CCTCAAAAATCACATGAGAATATTTCAATATTCTAT
3206781 CTGAATATAACTTTGATGCCGGTAGGCGTTGAGCAC ACAATAAAATACGGGACAATTGAATTCTATAGCGC
3206852 CTGAATATAACTTTGATGCCGTTAGGCGATTTAGAC