CRISPR Name CRISPR(position) REPEAT(sequence) SPACER(sequence)
CRISPR1 2423762 TTGCAGATTCTGTAGTTGTCCGATTTCCTTAGGAA AAACTGTGAGTCGGTTATTCACCAAATTCAATGT
2423831 TTGTAAATTCTGTAGCTGCCCCATTTCTTTAGGAA GTGCTGTGAGACGGTTTTCAGGTGAACATAACAT
2423900 TTGCAAATTCTGTAGTTGTCCTATTTCCTTTGGAA AAACTGTGAGTCGGTTATTCCGCAAATACAACTC
2423969 TTGTAAATTCTGTAGTTGTCCGATTTCGACAGGAA GAGTTGCGAGTTGGTTATCGCTCAAATTCAATGT
2424038 TTGTAAATTCTGTAATTGTCCTATTTCTTTTGGAA GTATCGTGAATTGGTTATCCTGCAAATCCAATGT
2424107 TTGTAAATTCTTCAATTGACCAATTTCCTTAGGAA GTGCTGTGAGTCGGTTCTCAGATAACCATAACTT
2424176 TTGTAAATTCTGTAACTGCCCTATTTCCTTTGGAA AAGTAGTAAGTTTGTTTTTATACAAACCCAAATC
2424245 TTGTAAATTCTGTAGCCGTCCTATTTCGTTAGGAA GTATTATGAGTCGGTTCTCAGATAAATCCAAACT
2424314 TTCTAACTTCTGTAACTCTACTATTACGGCAGGAA AAGTTGCGAGTTGGTTATCACGTAAATCTAATTC
2424383 CTGTAAATTCTCCAGTTGTCCAATTTCCTTTGGAA
CRISPR2 3160604 TCTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC CCGTTCTGATTTTTTCTTTTCCTTCCTTTTGTTA
3160675 TCTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC ACCCCACGATACTACCTGTCAGACCGTGCCCGGA
3160746 TCTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC GCACTCCTCGAACTGGTAAAACTACCGATGCTCG
3160817 CCTGAATATAACTTTGATGCCGTTAGGCGGTTTAGAA
CRISPR3 3161011 ACTTACAAAAATCGGGTGCCGGTAGGCGTTGAGCAC TTGATTGGTGCAGTTGTGCTTGTTTTGATTGGTGT
3161082 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC CCGTTCTGATTTTTTCTTTTCCTTCCTTTTGTTAT
3161153 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC CAGTAGATTTTGGATACACAAACCCGTTTGTGTTTC
3161225 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC GAATACAACCTCTTCAAAAAAGAGGAACCGGCGTA
3161296 CTGAATATAACTTTGATGCCGTTAGGCGATTTAGAT
CRISPR4 3161756 CTTACAAAAATCGGGATGTCGGTAGGCGTTGAGTAC TGAGTATGCAAATGAGCTTCGGCTTCGAATTCCCT
3161827 CTGAATATAACTTTGATGCCGTTAGGTGTTGAGCAC AAAGACAAATCGGTTCATTTGATTTTTTCGGATCT
3161898 CTGAATATAACTTTGATGCCGGTAGGCGTTGAGCAC GAGTTAAATTCTGCCCACTCCATGGCCTAAAATCAG
3161970 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC AGGGGCTATAAAATTGAGGTATCCTCAAAACGTAAA
3162042 CTGAATATAACTTTGATGCCGTTAGGCGGTTTAGAA
CRISPR5 3162190 CTTACAAAAATCGGGATGCCGGTAGGCGTTGAGCAC GAATAACTCGTTCGGAAAGCGTTCTGCGGATCTT
3162260 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC TCGTAAAGATCGTCTGCGTGTTCGTCGTGATACGTGT
3162333 CTGAATATAACTTTGATGCCGGTAGGCGTTGAGCAC AGCATAGCGGACGTGTTCTTTGTTCGTTTTATCGAA
3162405 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC AGCGTGCAACAAAACACGGAATACAATTCTCTTTGC
3162477 CTGAATATAACTTTGATGCCGTTAGGCGATTTAGAC