CRISPR Name CRISPR(position) REPEAT(sequence) SPACER(sequence)
CRISPR1 412488 CCGGTTCAACCCCACGCATGTGGGGAAAAG TTCGAGAGAGCAGGGATTTCTATTGCCAGTG
412549 TCGGTTCAACCCACGCATGTGGGGAAAAGA CCATACTCTAACAGGAGCTCCAGGAAGGAA
412609 CCGGTTCAACCCCACGCATGTGGGGAAAAG TAATCCTGAATGTAAAAGGCGCCCTGTTCC
412669 CCGGTTCAACCCCACGCATGTGGGGAAAAG