CRISPR Name CRISPR(position) REPEAT(sequence) SPACER(sequence)
CRISPR1 2424419 TTGCAGATTCTGTAGTTGTCCGATTTCCTTAGGAA AAACTGTGAGTCGGTTATTCACCAAATTCAATGT
2424488 TTGTAAATTCTGTAGCTGCCCCATTTCTTTAGGAA GTGCTGTGAGACGGTTTTCAGGTGAACATAACAT
2424557 TTGCAAATTCTGTAGTTGTCCTATTTCCTTTGGAA AAACTGTGAGTCGGTTATTCCGCAAATACAACTC
2424626 TTGTAAATTCTGTAGTTGTCCGATTTCGACAGGAA GAGTTGCGAGTTGGTTATCGCTCAAATTCAATGT
2424695 TTGTAAATTCTGTAATTGTCCTATTTCTTTTGGAA GTATCGTGAATTGGTTATCCTGCAAATCCAATGT
2424764 TTGTAAATTCTTCAATTGACCAATTTCCTTAGGAA GTGCTGTGAGTCGGTTCTCAGATAACCATAACTT
2424833 TTGTAAATTCTGTAACTGCCCTATTTCCTTTGGAA AAGTAGTAAGTTTGTTTTTATACAAACCCAAATC
2424902 TTGTAAATTCTGTAGCCGTCCTATTTCGTTAGGAA GTATTATGAGTCGGTTCTCAGATAAATCCAAACT
2424971 TTCTAACTTCTGTAACTCTACTATTACGGCAGGAA AAGTTGCGAGTTGGTTATCACGTAAATCTAATTC
2425040 CTGTAAATTCTCCAGTTGTCCAATTTCCTTTGGAA
CRISPR2 3163253 TCTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC CCGTTCTGATTTTTTCTTTTCCTTCCTTTTGTTA
3163324 TCTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC ACCCCACGATACTACCTGTCAGACCGTGCCCGGA
3163395 TCTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC GCACTCCTCGAACTGGTAAAACTACCGATGCTCG
3163466 CCTGAATATAACTTTGATGCCGTTAGGCGGTTTAGAA
CRISPR3 3163660 ACTTACAAAAATCGGGTGCCGGTAGGCGTTGAGCAC TTGATTGGTGCAGTTGTGCTTGTTTTGATTGGTGT
3163731 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC CCGTTCTGATTTTTTCTTTTCCTTCCTTTTGTTAT
3163802 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC CAGTAGATTTTGGATACACAAACCCGTTTGTGTTTC
3163874 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC GAATACAACCTCTTCAAAAAAGAGGAACCGGCGTA
3163945 CTGAATATAACTTTGATGCCGTTAGGCGATTTAGAT
CRISPR4 3164405 CTTACAAAAATCGGGATGTCGGTAGGCGTTGAGTAC TGAGTATGCAAATGAGCTTCGGCTTCGAATTCCCT
3164476 CTGAATATAACTTTGATGCCGTTAGGTGTTGAGCAC AAAGACAAATCGGTTCATTTGATTTTTTCGGATCT
3164547 CTGAATATAACTTTGATGCCGGTAGGCGTTGAGCAC GAGTTAAATTCTGCCCACTCCATGGCCTAAAATCAG
3164619 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC AGGGGCTATAAAATTGAGGTATCCTCAAAACGTAAA
3164691 CTGAATATAACTTTGATGCCGTTAGGCGGTTTAGAA
CRISPR5 3164839 CTTACAAAAATCGGGATGCCGGTAGGCGTTGAGCAC GAATAACTCGTTCGGAAAGCGTTCTGCGGATCTT
3164909 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC TCGTAAAGATCGTCTGCGTGTTCGTCGTGATACGTGT
3164982 CTGAATATAACTTTGATGCCGGTAGGCGTTGAGCAC AGCATAGCGGACGTGTTCTTTGTTCGTTTTATCGAA
3165054 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC AGCGTGCAACAAAACACGGAATACAATTCTCTTTGC
3165126 CTGAATATAACTTTGATGCCGTTAGGCGATTTAGAC
CRISPR6 3291830 TTTCCTAAAGAAATTGGGCAATTGAAGAACTTGCAA GAGTTGCATTTGAGTAGTAACCAATTCACTACT
3291899 CTTCCTAAAGAAATCGAACAACTACAAAATTTGAAA TCATTGGATTTATGGGATAATCAACTTAAAACC
3291968 CTTCCTAAGGAAATCGGAAAACTACAGAACTTGAAA TCGTTGGATTTGGGTAGCAACCAACTCACAATC
3292037 CTTCCAAAGGAAATCGGACAACTACAGAATTTGCAA AAATTGAATTTATGGAATAATCAACTTAAAACT
3292106 CTTCCTAAGGAAATTGGACAATTACAGAACTTGCAA AAAATGAATTTAGATAAAAACAGGCTCAATACA
3292175 CTTCCTAATGAAATTGGACAACTACAGAATTTGGAA TCGTTGTATTTGAATTATAACCAACTCACTATA
3292244 CTTCCAAAAGAAATTGGACAACTACAGAATTTGGAA TCGTTGTATTTGAATTATAACCAACTCACAATG
3292313 CTTCCACAAGAAATTGGACAACTACAGAATTTGGAA GGGTTGTATCTGAAATATAATCAACTCACAACC
3292382 CTTCCTAAAGAAATTGGACGACTACAGAATTTGAAA