CRISPR Name CRISPR(position) REPEAT(sequence) SPACER(sequence)
CRISPR1 3284965 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC CCAGCGGGATTCTTGGAAATAAATTACTCAACAAA
3285036 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC TTAAATCGGAAGCATGTTGCGACTCGATTTCGAAAT
3285108 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC CAAATATTCATGGCGCCTTGTCTCCCTGGGCTTCACA
3285181 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC TTTTGGACAACAACTTCCTCGCTCCCCGCATGTTCT
3285253 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC TAACAACATAGTCTTTAGAGATAGAGGCCATGACAAG
3285326 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC ACATACTAATTTTTGATCCAACTGTTGTTGTGTTAAT
3285399 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC ACAAAAAAAGACAAGTTGGTCCGGAATGCGTTTGGC
3285471 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC CTAGAGTGGCGTGAATTTTTGCATGAGTTGACCCTT
3285543 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC TATCGTTATCCGCCAAGGCGTTATCAGTTCTACAAT
3285615 CTGAATATAACTTTGATGCCGGTAGGCGTTGAGCAC TTAACAACCATATCTGTAGTCTTATATGCAATTTT
3285686 CTGAATATAACTTTGATGCCGGTAGGCGTTGAGCAC ATCGGAATATTTGCCCCTTTTGTATCATAGTCGTAA
3285758 CTGAATATAACTTTGATGCCGTTAGGCGATTTAGAC
3287142 ATATAAAGCTGAATATAACTTTGATGCCGATAGGCGTTGAGCACACGGA CCAACCAGGTATAAAACTCCAAC
3287214 AGATTACCCTGAATATAACTTTGATGCCGGTAGGCGTTGAGCACACGGA CCAACCAGGTATAAAACTCCAAC
3287286 AGATTACCCTGAATATAACTTTGATGCCGGTAGGCGTTGAGCACCCACG AAACAGATACAAAGCCTTCTAT
3287357 TTTTCCCTCTGAATATAACTTTGATGCCGGTAGGCGGTTTAGATGAGGA
3288309 CTTACAAAAATCGGGATGCCGTTAGGCGTTGAGCAC GAATAACTCGTTCGGAAAGCGTTCTGCGGATCTT
3288379 CTGAATATAACTTTGATGCCGGTAGGCGTTGAGCAC TTGATCGAAAGTCTTCGAATATTAAAATCCGATCC
3288450 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC GACAGAATATTAAAAACGAAAGAACAAGAAATCTTG
3288522 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC TTGATCACGACCGGGACTTTGATTGCTGTAGCTAT
3288593 CTGAATATAACTTTGATGCCGTTAGGCGGTTTAGAA
3288787 CTTACAAAAATCGGGATGCCGTTAGGCGTTGAGCAC TTATACGACGAGAGCGAGGTGGCGGCTCTGTTACGC
3288859 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC GCAAATTGAGTTTTAGGATTTCTGCTACAATATCTTT
3288932 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC CATTTTTGCTCTTCCTTAATATTCATTTTGTTTACT
3289004 CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC ACTTAAGACCAAATCGTAACGTCTGGTTTGAGACT
3289075 CTGAATATAACTTTGATGCCGTTAGGCGATTTAGAC