CRISPR Name CRISPR(position) REPEAT(sequence) SPACER(sequence)
CRISPR1 412937 CCGGTTCAACCCCACGCATGTGGGGAAAAG TTCGAGAGAGCAGGGATTTCTATTGCCAGTG
412998 TCGGTTCAACCCACGCATGTGGGGAAAAGA CCATACTCTAACAGGAGCTCCAGGAAGGAA
413058 CCGGTTCAACCCCACGCATGTGGGGAAAAG TAATCCTGAATGTAAAAGGCGCCCTGTTCC
413118 CCGGTTCAACCCCACGCATGTGGGGAAAAG
CRISPR2 1272004 GTCTAAATCGCCTACCGGCATCAAAGTTATATTCAG AATGGATGATCAAACAAAAAGGGACATAAACTAA
1272074 GTGCTCAACGCCTACCGACATCAAAGTTATATTCAG ACCGGCAAGGTAGACGAATTGTCAGACCCCGCAAA
1272145 GTGCTCAACGCCTATCGGCATCAAAGTTATATTCAG GTTGAGAGTCTCCGTCAATAGTTTGTAGGTATCG
1272215 GTGCTCAACGCCTAACGGCATCAAAGTTATATTCAG ACAAAAATGTAATTGCCACATTTTTGCTGTTTATTC
1272287 GTGCTCAACGCCTAACGGCATCAAAGTTATATTCAG ACTTATCTTCTAAATTTGTAATATTCAAAAGTCCAT
1272359 GTGCTCAACACCTAACGGCATCAAAGTTATATTCAG ATAGAATATTGAAATATTCTCATGTGATTTTTGAGG
1272431 GTGCTCAACGCCTAACGGCATCCCGATTTTTGTAAG
CRISPR3 1272623 ATCTAAACCGCCTAACGGCATCAAAGTTATATTCAGC AATGTTATCCGGCTTGATTATCGCGGGAGGCAG
1272693 GTGCTCAACGCCTAACGGCATCAAAGTTATATTCAGA GAAAAAAACCCGTTCCCGAACGGAGAAGGGGAATT
1272765 GTGCTCAACGCCTACCGGCATCAAAGTTATATTCAGA AAATTGCATATAAGACTACAGATATGGTTGTTAA
1272836 GTGCTCAACGCCTACCGGCATCAAAGTTATATTCAGA CCAAGCGTTTCCCTACCTGTAAAAAAACCTGTTATGCT
1272911 GTGCTCAACGCCTACCGGCATCAAAGTTATATTCAGA