CRISPR Name CRISPR(position) REPEAT(sequence) SPACER(sequence)
CRISPR1 412937 CCGGTTCAACCCCACGCATGTGGGGAAAAG TTCGAGAGAGCAGGGATTTCTATTGCCAGTG
412998 TCGGTTCAACCCACGCATGTGGGGAAAAGA CCATACTCTAACAGGAGCTCCAGGAAGGAA
413058 CCGGTTCAACCCCACGCATGTGGGGAAAAG TAATCCTGAATGTAAAAGGCGCCCTGTTCC
413118 CCGGTTCAACCCCACGCATGTGGGGAAAAG