Cas Gene(Begin position) Cas Gene(End position) Strand Annotation Description Cas Gene(Sequence) Cas Protein(Sequence)
1544830 1545963 + cd09641:cas3HD Type-I
Click Here
Click Here
1545964 1547067 + COG1203:cas3 Type-I
Click Here
Click Here
1547082 1547771 + cd09752:cas5 Subtype-I-C
Click Here
Click Here
1547861 1548073 + cd09642:cas8c Subtype-I-C
Click Here
Click Here
1548130 1549482 + pfam09709:cas8c Subtype-I-C
Click Here
Click Here
1549485 1550405 + cd09689:cas7 Subtype-I-C
Click Here
Click Here
1550545 1550973 + COG1468:cas4 other
Click Here
Click Here
1551275 1551991 + cd09634:cas1 universal
Click Here
Click Here
1551995 1552267 + cd09725:cas2 universal
Click Here
Click Here
3416845 3417468 - cd09693:cas5 Type-I
Click Here
Click Here
3417489 3418328 - cd09687:cas7 Subtype-I-B
Click Here
Click Here
3418393 3420279 - cd09713:cas8b3 Subtype-I-B
Click Here
Click Here
3420287 3422539 - cd09639:cas3 Type-I
Click Here
Click Here
3422536 3423168 - cd09703:cas6 other
Click Here
Click Here
3423629 3423883 . repeat:GTGCTCAACGCCTAACGGCATCAAAGTTATATTCAGA r1-s1:unk-r2-s2:unk-r3-s3:unk-r4
Click Here
Click Here
3423686 3423832 + unk unknown
Click Here
Click Here
3423919 3424131 + unk unknown
Click Here
Click Here
3424248 3424532 - pfam09827:cas2 universal
Click Here
Click Here
3424532 3425386 - cd09634:cas1 universal
Click Here
Click Here
3425555 3426184 - pfam01930:cas4 Type-I
Click Here
Click Here
3694993 3695478 - cd09654:cmr5gr11 Subtype-III-B
Click Here
Click Here
3695532 3697472 - unk unknown
Click Here
Click Here
3697589 3698227 + cd06127:DEDDh Type-I
Click Here
Click Here
3698440 3699603 + unk unknown
Click Here
Click Here
3699976 3700566 + cd09641:cas3HD Type-I
Click Here
Click Here
3701523 3701912 - unk unknown
Click Here
Click Here
3702255 3703178 - unk unknown
Click Here
Click Here
3703523 3704476 + COG2378:WYL other
Click Here
Click Here