Cas Gene(Begin position) Cas Gene(End position) Strand Annotation Description Cas Gene(Sequence) Cas Protein(Sequence)
727419 727996 . repeat:CGGTTCAACCCCACGCATGTGGGGAAAAG r1-s1:unk-r2-s2:unk-r3-s3:unk-r4-s4:unk-r5-s5:unk-r6-s6:unk-r7-s7:unk-r8-s8:unk-r9-s9:unk-r10
Click Here
Click Here
728038 728361 - cd09755:cas2 universal
Click Here
Click Here
728381 729265 - cd09719:cas1 universal
Click Here
Click Here
729486 730286 - cd09727:cas6e Subtype-I-E
Click Here
Click Here
730339 730503 - unk unknown
Click Here
Click Here
730574 731314 - cd09645:cas5 Subtype-I-E
Click Here
Click Here
731315 732337 - pfam09344:cas7 Subtype-I-E
Click Here
Click Here
732385 732921 - cd09731:cse2gr11 Subtype-I-E
Click Here
Click Here
732927 734417 - pfam09481:cas8e Subtype-I-E
Click Here
Click Here
734525 737323 - COG1203:cas3 Type-I
Click Here
Click Here
843351 843565 . repeat:CCACGGTTCAACCCCACGCATGTGGGGAAAAG r1-s10:unk-r2-s11:unk-r3-s12:unk-r4
Click Here
Click Here
3073836 3074166 . repeat:CTTTTCCCCACATGCGTGGGGTTGAACC r1-s24:unk-r2-s25:unk-r3-s26:unk-r4-s27:unk-r5-s28:unk-r6
Click Here
Click Here
3341521 3342132 + cd09703:cas6 other
Click Here
Click Here
3342141 3344408 + cd09641:cas3HD Type-I
Click Here
Click Here
3344432 3345994 + cd09713:cas8b3 Subtype-I-B
Click Here
Click Here
3346011 3346907 + cd09687:cas7 Subtype-I-B
Click Here
Click Here
3346940 3347542 + cd09693:cas5 Type-I
Click Here
Click Here
3347789 3347920 + unk unknown
Click Here
Click Here
3348118 3349551 + cd09636:cas1 universal
Click Here
Click Here
3349647 3350054 + pfam09827:cas2 universal
Click Here
Click Here
3350420 3350672 . repeat:CTGAATATAACTTTGATGCCGTAAGGCGTTGAGCAC r1-s29:unk-r2-s30:unk-r3-s31:unk-r4
Click Here
Click Here