Cas Gene(Begin position) Cas Gene(End position) Strand Annotation Description Cas Gene(Sequence) Cas Protein(Sequence)
700571 700861 - cd09725:cas2 universal
Click Here
Click Here
700865 701278 - cd09634:cas1 universal
Click Here
Click Here
701988 702155 - COG1468:cas4 other
Click Here
Click Here
702455 703375 - cd09689:cas7 Subtype-I-C
Click Here
Click Here
703378 705000 - cd09642:cas8c Subtype-I-C
Click Here
Click Here
705090 705779 - cd09752:cas5 Subtype-I-C
Click Here
Click Here
705794 708022 - cd09641:cas3HD Type-I
Click Here
Click Here
3122125 3122367 . repeat:CACTTCCTCTTGAATAAGAGAAAGAAACG r1-s13:unk-r2-s14:unk-r3-s15:unk-r4
Click Here
Click Here