Cas Gene(Begin position) Cas Gene(End position) Strand Annotation Description Cas Gene(Sequence) Cas Protein(Sequence)
700572 700862 - cd09725:cas2 universal
Click Here
Click Here
700866 701279 - cd09634:cas1 universal
Click Here
Click Here
701989 702156 - COG1468:cas4 other
Click Here
Click Here
702456 703376 - cd09689:cas7 Subtype-I-C
Click Here
Click Here
703379 705001 - cd09642:cas8c Subtype-I-C
Click Here
Click Here
705091 705780 - cd09752:cas5 Subtype-I-C
Click Here
Click Here
705795 708023 - cd09641:cas3HD Type-I
Click Here
Click Here
3122078 3122320 . repeat:CACTTCCTCTTGAATAAGAGAAAGAAACG r1-s13:unk-r2-s14:unk-r3-s15:unk-r4
Click Here
Click Here