Cas Gene(Begin position) Cas Gene(End position) Strand Annotation Description Cas Gene(Sequence) Cas Protein(Sequence)
1136094 1136343 . repeat:GTTTCTTTCTCTTATTCAAGAGGAAGTGCATTGAAA r1-s1:unk-r2-s2:unk-r3-s3:unk-r4
Click Here
Click Here
3200637 3202289 + cd09634:cas1 universal
Click Here
Click Here
3202358 3202573 + pfam09827:cas2 universal
Click Here
Click Here
3202940 3204121 . repeat:CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC r1-s4:unk-r2-s5:unk-r3-s6:unk-r4-s7:unk-r5-s8:unk-r6-s9:unk-r7-s10:unk-r8-s11:unk-r9-s12:unk-r10-s13:unk-r11-s14:unk-r12-s15:unk-r13-s16:unk-r14-s17:unk-r15-s18:unk-r16-s19:unk-r17
Click Here
Click Here
3204542 3204790 . repeat:CTGAATATAACTTTGATGCCGGTAGGCGTTGAGCAC r1-s20:unk-r2-s21:unk-r3-s22:unk-r4
Click Here
Click Here
3206161 3206481 . repeat:CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC r1-s23:unk-r2-s24:unk-r3-s25:unk-r4-s26:unk-r5
Click Here
Click Here
3206638 3206887 . repeat:CTGAATATAACTTTGATGCCGGTAGGCGTTGAGCAC r1-s27:unk-r2-s28:unk-r3-s29:unk-r4
Click Here
Click Here
3207738 3210626 + cd09703:cas6 other
Click Here
Click Here
3210628 3212511 + cd09713:cas8b3 Subtype-I-B
Click Here
Click Here
3212576 3213415 + cd09687:cas7 Subtype-I-B
Click Here
Click Here
3213436 3214059 + cd09693:cas5 Type-I
Click Here
Click Here
3596549 3597682 + cd09641:cas3HD Type-I
Click Here
Click Here
3597683 3598786 + COG1203:cas3 Type-I
Click Here
Click Here
3598801 3599490 + cd09752:cas5 Subtype-I-C
Click Here
Click Here
3599580 3601202 + cd09642:cas8c Subtype-I-C
Click Here
Click Here
3601205 3602125 + cd09689:cas7 Subtype-I-C
Click Here
Click Here
3602425 3602697 + COG1468:cas4 other
Click Here
Click Here
3602999 3603715 + cd09634:cas1 universal
Click Here
Click Here
3603719 3604009 + cd09725:cas2 universal
Click Here
Click Here