Cas Gene(Begin position) Cas Gene(End position) Strand Annotation Description Cas Gene(Sequence) Cas Protein(Sequence)
685919 686095 - cd09638:cas2 universal
Click Here
Click Here
686099 686815 - cd09634:cas1 universal
Click Here
Click Here
687117 687389 - COG1468:cas4 other
Click Here
Click Here
687689 688609 - cd09689:cas7 Subtype-I-C
Click Here
Click Here
688612 690234 - cd09642:cas8c Subtype-I-C
Click Here
Click Here
690324 691013 - cd09752:cas5 Subtype-I-C
Click Here
Click Here
691028 692131 - COG1203:cas3 Type-I
Click Here
Click Here
692132 693265 - cd09641:cas3HD Type-I
Click Here
Click Here
2423762 2424417 . repeat:TTGTAAATTCTGTAGTTGTCCTATTTCCTTAGGAA r1-s1:unk-r2-s2:unk-r3-s3:unk-r4-s4:unk-r5-s5:unk-r6-s6:unk-r7-s7:unk-r8-s8:unk-r9-s9:unk-r10
Click Here
Click Here
3158303 3159955 + cd09634:cas1 universal
Click Here
Click Here
3160024 3160239 + pfam09827:cas2 universal
Click Here
Click Here
3160604 3160853 . repeat:TCTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC r1-s31:unk-r2-s32:unk-r3-s33:unk-r4
Click Here
Click Here
3161011 3161331 . repeat:CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC r1-s34:unk-r2-s35:unk-r3-s36:unk-r4-s37:unk-r5
Click Here
Click Here
3161756 3162077 . repeat:CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC r1-s38:unk-r2-s39:unk-r3-s40:unk-r4-s41:unk-r5
Click Here
Click Here
3162190 3162512 . repeat:CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC r1-s42:unk-r2-s43:unk-r3-s44:unk-r4-s45:unk-r5
Click Here
Click Here
3164032 3164664 + cd09703:cas6 other
Click Here
Click Here
3164703 3166919 + cd09639:cas3 Type-I
Click Here
Click Here
3166921 3168804 + cd09713:cas8b3 Subtype-I-B
Click Here
Click Here
3168869 3169708 + cd09687:cas7 Subtype-I-B
Click Here
Click Here
3169729 3170352 + cd09693:cas5 Type-I
Click Here
Click Here