Cas Gene(Begin position) Cas Gene(End position) Strand Annotation Description Cas Gene(Sequence) Cas Protein(Sequence)
686527 686703 - cd09638:cas2 universal
Click Here
Click Here
686707 687423 - cd09634:cas1 universal
Click Here
Click Here
687725 687997 - COG1468:cas4 other
Click Here
Click Here
688297 689217 - cd09689:cas7 Subtype-I-C
Click Here
Click Here
689220 690842 - cd09642:cas8c Subtype-I-C
Click Here
Click Here
690932 691621 - cd09752:cas5 Subtype-I-C
Click Here
Click Here
691636 692739 - COG1203:cas3 Type-I
Click Here
Click Here
692740 693873 - cd09641:cas3HD Type-I
Click Here
Click Here
2424419 2425074 . repeat:TTGTAAATTCTGTAGTTGTCCTATTTCCTTAGGAA r1-s1:unk-r2-s2:unk-r3-s3:unk-r4-s4:unk-r5-s5:unk-r6-s6:unk-r7-s7:unk-r8-s8:unk-r9-s9:unk-r10
Click Here
Click Here
3160952 3162604 + cd09634:cas1 universal
Click Here
Click Here
3162604 3162888 + pfam09827:cas2 universal
Click Here
Click Here
3163253 3163502 . repeat:TCTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC r1-s31:unk-r2-s32:unk-r3-s33:unk-r4
Click Here
Click Here
3163660 3163980 . repeat:CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC r1-s34:unk-r2-s35:unk-r3-s36:unk-r4-s37:unk-r5
Click Here
Click Here
3164405 3164726 . repeat:CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC r1-s38:unk-r2-s39:unk-r3-s40:unk-r4-s41:unk-r5
Click Here
Click Here
3164839 3165161 . repeat:CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC r1-s42:unk-r2-s43:unk-r3-s44:unk-r4-s45:unk-r5
Click Here
Click Here
3166681 3167313 + cd09703:cas6 other
Click Here
Click Here
3167310 3169568 + cd09639:cas3 Type-I
Click Here
Click Here
3169570 3171453 + cd09713:cas8b3 Subtype-I-B
Click Here
Click Here
3171518 3172357 + cd09687:cas7 Subtype-I-B
Click Here
Click Here
3172378 3173001 + cd09693:cas5 Type-I
Click Here
Click Here
3291830 3292417 . repeat:CTTCCTAAAGAAATTGGACAACTACAGAATTTGAAA r1-s61:unk-r2-s62:unk-r3-s63:unk-r4-s64:unk-r5-s65:unk-r6-s66:unk-r7-s67:unk-r8-s68:unk-r9
Click Here
Click Here