Cas Gene(Begin position) Cas Gene(End position) Strand Annotation Description Cas Gene(Sequence) Cas Protein(Sequence)
3150422 3153925 + pfam00078:RT other
Click Here
Click Here
3153937 3154653 + cd06127:DEDDh Type-I
Click Here
Click Here
3154811 3155710 - unk unknown
Click Here
Click Here
3156200 3156568 + unk unknown
Click Here
Click Here
3156926 3158224 + pfam00078:RT other
Click Here
Click Here
3282662 3284314 + cd09634:cas1 universal
Click Here
Click Here
3284314 3284598 + pfam09827:cas2 universal
Click Here
Click Here
3284965 3285793 . repeat:CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC r1-s1:unk-r2-s2:unk-r3-s3:unk-r4-s4:unk-r5-s5:unk-r6-s6:unk-r7-s7:unk-r8-s8:unk-r9-s9:unk-r10-s10:unk-r11-s11:unk-r12
Click Here
Click Here
3287142 3287405 . repeat:ATATTACCCTGAATATAACTTTGATGCCGGTAGGCGTTGAGCACACGGA r1-s12:unk-r2-s13:unk-r3-s14:unk-r4
Click Here
Click Here
3288309 3288628 . repeat:CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC r1-s15:unk-r2-s16:unk-r3-s17:unk-r4-s18:unk-r5
Click Here
Click Here
3288787 3289110 . repeat:CTGAATATAACTTTGATGCCGTTAGGCGTTGAGCAC r1-s19:unk-r2-s20:unk-r3-s21:unk-r4-s22:unk-r5
Click Here
Click Here
3290305 3290937 + cd09703:cas6 other
Click Here
Click Here
3290934 3293192 + cd09639:cas3 Type-I
Click Here
Click Here
3293194 3295077 + cd09713:cas8b3 Subtype-I-B
Click Here
Click Here
3295142 3295981 + cd09687:cas7 Subtype-I-B
Click Here
Click Here
3296002 3296625 + cd09693:cas5 Type-I
Click Here
Click Here
3669771 3672008 + cd09641:cas3HD Type-I
Click Here
Click Here
3672023 3672712 + cd09752:cas5 Subtype-I-C
Click Here
Click Here
3672802 3674424 + cd09642:cas8c Subtype-I-C
Click Here
Click Here
3674427 3675347 + cd09689:cas7 Subtype-I-C
Click Here
Click Here
3675647 3675919 + COG1468:cas4 other
Click Here
Click Here
3676221 3676937 + cd09634:cas1 universal
Click Here
Click Here
3676941 3677213 + cd09725:cas2 universal
Click Here
Click Here