Cas Gene(Begin position) Cas Gene(End position) Strand Annotation Description Cas Gene(Sequence) Cas Protein(Sequence)
1127064 1127687 - cd09693:cas5 Type-I
Click Here
Click Here
1127708 1128547 - cd09687:cas7 Subtype-I-B
Click Here
Click Here
1128612 1130498 - cd09713:cas8b3 Subtype-I-B
Click Here
Click Here
1130506 1132758 - cd09639:cas3 Type-I
Click Here
Click Here
1132755 1133387 - cd09703:cas6 other
Click Here
Click Here
1133848 1134102 . repeat:GTGCTCAACGCCTAACGGCATCAAAGTTATATTCAGA r1-s1:unk-r2-s2:unk-r3-s3:unk-r4
Click Here
Click Here
1133905 1134051 + unk unknown
Click Here
Click Here
1134138 1134350 + unk unknown
Click Here
Click Here
1134467 1134751 - pfam09827:cas2 universal
Click Here
Click Here
1134751 1135605 - cd09634:cas1 universal
Click Here
Click Here
1135774 1136403 - pfam01930:cas4 Type-I
Click Here
Click Here
1405220 1405705 - cd09654:cmr5gr11 Subtype-III-B
Click Here
Click Here
1405759 1407699 - unk unknown
Click Here
Click Here
1407816 1408454 + cd06127:DEDDh Type-I
Click Here
Click Here
1408667 1409830 + unk unknown
Click Here
Click Here
1410203 1410793 + cd09641:cas3HD Type-I
Click Here
Click Here
1411750 1412139 - unk unknown
Click Here
Click Here
1412482 1413405 - unk unknown
Click Here
Click Here
1413750 1414703 + COG2378:WYL other
Click Here
Click Here
3535328 3536461 + cd09641:cas3HD Type-I
Click Here
Click Here
3536462 3537565 + COG1203:cas3 Type-I
Click Here
Click Here
3537580 3538269 + cd09752:cas5 Subtype-I-C
Click Here
Click Here
3538359 3539981 + cd09642:cas8c Subtype-I-C
Click Here
Click Here
3539984 3540904 + cd09689:cas7 Subtype-I-C
Click Here
Click Here
3541044 3541472 + COG1468:cas4 other
Click Here
Click Here
3541774 3542490 + cd09634:cas1 universal
Click Here
Click Here
3542494 3542766 + cd09725:cas2 universal
Click Here
Click Here