Cas Gene(Begin position) Cas Gene(End position) Strand Annotation Description Cas Gene(Sequence) Cas Protein(Sequence)
1073422 1073671 . repeat:GTTTCTTTCTCTTATTCAAGAGGAAGTGCATTGAAA r1-s1:unk-r2-s2:unk-r3-s3:unk-r4
Click Here
Click Here
1265008 1265631 - cd09693:cas5 Type-I
Click Here
Click Here
1265652 1266491 - cd09687:cas7 Subtype-I-B
Click Here
Click Here
1266556 1268439 - cd09713:cas8b3 Subtype-I-B
Click Here
Click Here
1268441 1269706 - cd09639:cas3 Type-I
Click Here
Click Here
1269685 1270743 - cd09641:cas3HD Type-I
Click Here
Click Here
1270740 1271372 - cd09703:cas6 other
Click Here
Click Here
1272004 1272466 . repeat:GTGCTCAACGCCTAACGGCATCAAAGTTATATTCAG r1-s4:unk-r2-s5:unk-r3-s6:unk-r4-s7:unk-r5-s8:unk-r6-s9:unk-r7
Click Here
Click Here
1272274 1272465 + unk unknown
Click Here
Click Here
1272623 1272947 . repeat:GTGCTCAACGCCTACCGGCATCAAAGTTATATTCAGA r1-s10:unk-r2-s11:unk-r3-s12:unk-r4-s13:unk-r5
Click Here
Click Here
1272797 1272931 - unk unknown
Click Here
Click Here
1272983 1273180 + unk unknown
Click Here
Click Here
1273297 1273581 - pfam09827:cas2 universal
Click Here
Click Here
1273581 1275233 - cd09634:cas1 universal
Click Here
Click Here
2977341 2978294 - COG2378:WYL other
Click Here
Click Here
2978773 2979735 + unk unknown
Click Here
Click Here
2980078 2980467 + unk unknown
Click Here
Click Here
2981761 2982351 - cd09641:cas3HD Type-I
Click Here
Click Here
2982723 2983886 - unk unknown
Click Here
Click Here
2984099 2984737 - cd06127:DEDDh Type-I
Click Here
Click Here
2984854 2986794 + unk unknown
Click Here
Click Here
2986848 2987333 + cd09654:cmr5gr11 Subtype-III-B
Click Here
Click Here
3649275 3650408 + cd09641:cas3HD Type-I
Click Here
Click Here
3650409 3651512 + COG1203:cas3 Type-I
Click Here
Click Here
3651527 3652216 + cd09752:cas5 Subtype-I-C
Click Here
Click Here
3652306 3653928 + cd09642:cas8c Subtype-I-C
Click Here
Click Here
3653931 3654281 + cd09689:cas7 Subtype-I-C
Click Here
Click Here
3654253 3654852 + pfam05107:cas7b Type-I
Click Here
Click Here
3655124 3655423 + unk unknown
Click Here
Click Here
3655429 3656271 + unk unknown
Click Here
Click Here
3656276 3656662 + COG1468:cas4 other
Click Here
Click Here
3656964 3657680 + cd09634:cas1 universal
Click Here
Click Here
3657684 3657974 + cd09725:cas2 universal
Click Here
Click Here