Cas Gene(Begin position) Cas Gene(End position) Strand Annotation Description Cas Gene(Sequence) Cas Protein(Sequence)
412937 413147 . repeat:CCGGTTCAACCCCACGCATGTGGGGAAAAG r1-s1:unk-r2-s2:unk-r3-s3:unk-r4
Click Here
Click Here
2930308 2931081 + cd09641:cas3HD Type-I
Click Here
Click Here
2931144 2933111 + COG1203:cas3 Type-I
Click Here
Click Here
2933123 2933686 + cd09729:cas8e Subtype-I-E
Click Here
Click Here
2933664 2934416 + cd09729:cas8e Subtype-I-E
Click Here
Click Here
2934422 2934730 + pfam09481:cas8e Subtype-I-E
Click Here
Click Here
2934736 2935272 + cd09731:cse2gr11 Subtype-I-E
Click Here
Click Here
2935269 2936342 + pfam09344:cas7 Subtype-I-E
Click Here
Click Here
2936343 2936753 + pfam09704:cas5 Type-I
Click Here
Click Here
2936740 2937090 + pfam09704:cas5 Type-I
Click Here
Click Here
2937361 2938161 + cd09727:cas6e Subtype-I-E
Click Here
Click Here
2938178 2938435 - unk unknown
Click Here
Click Here
2938455 2939000 - unk unknown
Click Here
Click Here
2939083 2939427 - unk unknown
Click Here
Click Here
2939931 2940815 + cd09719:cas1 universal
Click Here
Click Here
2940748 2941167 + pfam09707:cas2 universal
Click Here
Click Here